Plasmid Name pET-21 b (+)

Alt Names pET21b

Source/Vendor EMD Biosciences

Plasmid Type Bacterial

Viral/Non-viral Nonviral

Stable/Transient Transient

Constitutive/Inducible Constitutive

Expression Level High

Plasmid Size 5442

Sequencing Primer T7 Fwd

Sequencing Primer Sequence 5d[TAATACGACTCACTATAGGG]3

Sequence

Protein Tags T7 (Nterm), His (Cterm)

Bacterial Resistance Ampicillin

Notes Same as pET24abcd(+) but ampR; a,b,c,d vary by MCS; The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand.

Catalog Number 69741-3

Plasmid Sequence View Sequence